Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
rno_circRNA_001168 | |||
Gene | LOC681740 | Organism | Rat |
Genome Locus | n/a | Build | n/a |
Disease | Traumatic brain injury | ICD-10 | Intracranial laceration and haemorrhage due to birth injury (P10) |
DBLink | Link to database | PMID | 29357736 |
Experimental Method | |||
Sample Type | Neuronal Tissues | Comparison | tissue samples before and after brain injury |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TGAGATCACTGCCAGCTTTCG ReverseTTATTCCCATGCGTCCTTTAGG | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Xie, BS, Wang, YQ, Lin, Y, Zhao, CC, Mao, Q, Feng, JF, Cao, JY, Gao, GY, Jiang, JY (2018). Circular RNA Expression Profiles Alter Significantly after Traumatic Brain Injury in Rats. J. Neurotrauma, 35, 14:1659-1666. |